|
||

From the * Department of Pharmacology and
Department of Physiology, The University of Connecticut Health Center, Farmington,
Connecticut 06030
| |
ABSTRACT |
|---|
|
|
|---|
To study the role of the inositol 1,3,4,5-trisphosphate-binding protein GAP1IP4BP in store-operated
Ca2+ entry, we established a human erythroleukemia (HEL) cell line in which the expression of GAP1IP4BP was substantially reduced by transfection with a vector containing antisense DNA under control of a Rous Sarcoma virus
promoter and the Escherichia coli LacI repressor (AS-HEL cells). Control cells were transfected with vector lacking
antisense DNA (V-HEL cells). GAP1IP4BP protein, which is a member of the GTPase-activating protein (GAP1) family, was reduced by 85% in AS-HEL cells and was further reduced by 96% by treatment with isopropylthio-
-D-
galactoside to relieve LacI repression. The loss of GAP1IP4BP was associated with both a membrane hyperpolarization
and a substantially increased Ca2+ entry induced by thrombin or thapsigargin. The activation of intermediate conductance Ca2+-activated K+ channels in AS-HEL cells (not seen in V-HEL cells) was responsible for the membrane
hyperpolarization and the enhanced Ca2+ entry, and both were blocked by charybdotoxin. Stimulated V-HEL cells
did not hyperpolarize and basal Ca2+ influx was unaffected by charybdotoxin. In V-HEL cells hyperpolarized by removal of extracellular K+, the thapsigargin-stimulated Ca2+ influx was increased. Expression of mRNA for the human Ca2+-activated intermediate conductance channel KCa4 was equivalent in both AS-HEL and V-HEL cells, suggesting that the specific appearance of calcium-activated potassium current (IK(Ca)) in AS-HEL cells was possibly
due to modulation of preexisting channels. Our results demonstrate that GAP1IP4BP, likely working through a signaling pathway dependent on a small GTP-binding protein, can regulate the function of K(Ca) channels that produce a hyperpolarizing current that substantially enhances the magnitude and time course of Ca2+ entry subsequent to the release of internal Ca2+ stores.
| |
INTRODUCTION |
|---|
|
|
|---|
Many electrically nonexcitable cells respond to agonist
stimulation with an increase of intracellular free calcium ([Ca2+]i), which results from an inositol 1,4,5-trisphosphate (InsP3)1-induced release of calcium from
internal calcium stores followed by calcium entry from
the extracellular space. It is now widely accepted that,
in many cases, activation of calcium entry is controlled by emptying of InsP3-sensitive stores, although the cellular mechanisms that relay the signal from the internal calcium stores to the channels in the plasma membrane are poorly understood. Nevertheless, a number
of molecular species have been proposed to play a role in store-operated calcium entry (reviewed by Irvine,
1990
, 1992
; Putney and Bird, 1993
; Berridge, 1995
;
Clapham, 1995
; Parekh and Penner, 1997
). Among
these are small GTPase protein(s) and inositol 1,3,4,5-tetrakisphosphate (InsP4), both of which have been
proposed to participate in the activation and regulation
of store-operated calcium entry (Irvine, 1992
; Bird and
Putney, 1993
; Fasolato et al., 1993
).
Bird and Putney (1993)
reported that microinjection
of the nonhydrolyzable analogues of GTP, GTP
S, or
GDP
S into mouse lacrimal acinar cells blocked calcium entry induced by thapsigargin. The effect of these
guanine nucleotide analogues could be reversed by including GTP in the injection pipette. Fasolato et al.
(1993)
reported that introduction of GTP
S via a patch
pipette blocked the activation of the calcium release-
activated calcium current (ICRAC) by ionomycin or photoreleased caged InsP3 in rat basophilic leukemia cells.
Interestingly, once ICRAC had been activated, GTP
S no
longer had an inhibitory effect, suggesting that GTP was required during a step before the activation of
ICRAC. The two groups independently reached a similar
conclusion, that activation of calcium entry or ICRAC involved hydrolysis of GTP, most likely by a small GTP-binding protein. Additionally, small GTPase proteins (e.g., Ras) may influence calcium entry indirectly by
controlling the expression of K(Ca) channels (Huang
and Rane, 1994
; Draheim et al., 1995
). When [Ca2+]i
rises, activation of K(Ca) channels will hyperpolarize
the plasma membrane and thereby facilitate calcium
entry (Parekh and Penner, 1997
). If small GTPase proteins participate in the activation or regulation of ICRAC,
it is possible that a GTPase-activating protein may play a
role in the process because of the slow intrinsic GTP hydrolysis rate of small GTP-binding proteins (Boguski
and McCormick, 1993
).
InsP4 is produced from InsP3 by Ins(1,4,5)P3-3-kinase
(Batty et al., 1985
; Irvine et al., 1986
). Whether InsP4 is
involved in activation of calcium entry remains controversial. There is a body of evidence suggesting that
InsP4 may activate or facilitate calcium entry (Irvine
and Moor, 1986
; Morris et al., 1987
; Changya et al.,
1989a
,b; Guse et al., 1992
; Luckhoff and Clapham,
1992
; O'Rourke et al., 1996
). Others find no evidence
for the involvement of InsP4 in activation of calcium entry (Bird et al., 1991
; Fasolato et al., 1993
). In addition,
Bird and Putney (1996)
reported that microinjection
of a high concentration InsP4 in mouse lacrimal cells
blocked calcium entry induced by inositol-2,4,5 trisphosphate. However, InsP4 activated a K(Ca) channel in a
smooth muscle cell line (Molleman et al., 1991
) that
may indirectly influence calcium entry by hyperpolarizing the plasma membrane.
Multiple InsP4 binding sites have been found in different tissues, and several InsP4-binding proteins have
been identified (Bradford and Irvine, 1987
; Enyedi and
Williams, 1988
; Donie et al., 1990
; Donie and Reiser,
1991
; Theibert et al., 1991
; Koppler et al., 1994
, 1996
;
Cullen et al., 1995a
,b; Fukuda and Mikoshiba, 1996
;
O'Rourke et al., 1996
). Among them is GAP1IP4BP, a
member of the GAP1 protein family (Cullen et al.,
1997
). GAP1IP4BP has the potential to integrate the inositol phosphate pathway and the small GTP-binding protein pathways, both of which have been suggested to
participate in the activation or regulation of calcium
entry (see above). To examine whether GAP1IP4BP is involved in calcium entry, a human erythroleukemia
(HEL) cell line was established in which the expression
of GAP1IP4BP protein was substantially reduced using
antisense techniques. In this cell line, calcium influx
was increased in response to thrombin and thapsigargin. Our findings indicate that the increased calcium
entry resulted from membrane hyperpolarization
caused by intermediate conductance K(Ca) channels.
Based on previous measurements of the voltage dependence of ICRAC in HEL cells, we suggest that the increased calcium influx results from an increase in ICRAC
due to the hyperpolarization. We also suggest a possible mechanism by which reduced expression of GAP1IP4BP
might cause an increase in the function of the K(Ca)
channels.
| |
MATERIALS AND METHODS |
|---|
|
|
|---|
Establishment of GAP1IP4BP Antisense-transfected Cell Lines
The antisense strategy employed the "Lac Switch" mammalian expression system in which expression of the antisense cDNA occurs from a Rous Sarcoma virus (RSV) long terminal repeat promoter that contains the Escherichia coli lacI repressor. Release from repression can be induced by isopropylthio-
-D-galactoside (IPTG). All molecular biological procedures were performed following
standard protocols (Sambrook et al., 1989
; Ausubel et al., 1994
)
unless specified otherwise. The cDNA fragment corresponding
to nucleotides 80-454 (375 nucleotides) of GAP1IP4BP was amplified in a reverse transcription PCR using a primer pair to which a
Not1 restriction enzyme cutting site was attached (sense primer:
5'GAAAAAAGCGGCCGCTGAAGATCAAGATCGGTGAAGCC3';
antisense primer: 5'GAAAAAAGCGGCCGCTGTCTGTGATGACCTCGCTCAG3'; Not1 cutting site underlined). The PCR protocol
was: 94°C, 5 min; 94°C, 45 s; 58°C, 1 min; 72°C, 1 min; 30 cycles.
The PCR product was gel purified and digested with Not1 restriction enzyme at 37°C for 12 h. The plasmid pOPRSVICAT (Stratagene Inc.) was digested with the Not1 and the 5.6-kb vector backbone (pOPRSVICAT) was recovered by gel purification. The
purified GAP1IP4BP fragment and pOPRSVICAT were ligated
yielding a plasmid (pOPRSVIGAP1IP4BPAS) with the 375-nucleotide GAP1IP4BP cDNA in antisense orientation. Religated plasmid
backbone pOPRSVICAT was used as a transfection control.
HEL cells were first transfected with plasmid p3'SS, which carries E. coli lacI and a hygromycin resistance gene (Stratagene Inc.), using the calcium phosphate precipitation method. Transfected cells were selected using 400 µg/ml hygromycin and further cloned by limiting dilution. The cloned p3'SS transfected cells (LacI-HEL cells) were cotransfected with pOPRSVIGAP1IP4BPAS or pOPRSVICAT, which carry a geneticin resistance gene, to establish the GAP1IP4BP antisense (AS-HEL) and vector transfected (V-HEL) control cell lines. The cotransfected cells were selected using 300 µg/ml geneticin and maintained in Hybrimax (Sigma Chemical Co.) supplemented with 10% fetal bovine serum with the above antibiotics. A primer pair, in which one primer binds to the GAP1IP4BP insert and the other binds to the vector backbone, was used to amplify genomic DNA to verify the presence of the pOPRSVIGAP1IP4BPAS plasmid in the genome of the transfected cell line. The primer pair was: 5'GAAAAAAGCGGCCGCTGAAGATCAAGATCGGTGAAGCC3', 5'GTTCAAAGAACTGCTCCTCAGGG3'.
Western Blot of GAP1IP4BP
We produced polyclonal antisera from rabbits raised against the
COOH-terminal 20 amino acid residues of GAP1IP4BP and also
used an antiserum obtained from Dr. Peter Cullen (Cullen et al.,
1995b
) to determine the expression of the protein in the cell
lines by quantitative Western blot analysis as described by
O'Rourke et al. (1996)
.
Solutions
The following external solutions were used for the calcium imaging and electrophysiological experiments. (1) HEPES-buffered physiological salt solution (HPSS) contained (mM): 120 NaCl, 5.3 KCl, 1.0 MgSO4, 1.8 CaCl2, 5.5 glucose, 20 HEPES-Na, pH 7.4 (with NaOH). (2) Ca2+-free HPSS was made by omitting CaCl2 and adding 0.5 mM EGTA. (3) External solution for patch clamp experiments (mM): 150 NaCl, 4.5 KCl, 1.0 MgCl2, 10 D-glucose, 1.8 CaCl2, and 10 HEPES, pH 7.4 with NaOH. (4) Calcium-free solution derived from external solution 3 by replacing CaCl2 with the same amount of MgCl2 and with 0.5 mM EGTA added. (5) For measurement of the reversal potential of the calcium-activated potassium current, we used external solution 3 with K+ concentrations of 4.5, 45, and 140 mM K+, and NaCl was adjusted accordingly to maintain osmolarity.
The following pipette solutions were used in the electrophysiological experiments. (1) For measurement of calcium-activated potassium current (IK(Ca)), the internal solution contained
(mM): 140KCl, 1.0 MgCl2, 0.1 BAPTA, and 10 HEPES, pH 7.2 with KOH. (2) For current clamp experiments, the internal solution contained (mM): 140 K aspartate, 8.0 NaCl, 1.0 MgCl2, 1 EGTA, 0.37 CaCl2, 10 HEPES, pH 7.2 with KOH. The calculated
free calcium concentration of the solution is 100 nM. (c) To dialyze cells with intracellular solutions with different buffered free
calcium concentrations, the internal solution contained (mM):
140 KCl, 10 EGTA, 10 HEPES, pH 7.4 with KOH. Total Mg2+ and
total Ca2+ concentrations were calculated using previously published equations (Fabiato and Fabiato, 1979
) to achieve a constant free Mg2+ concentration of 1.0 mM and a given free Ca2+
concentration.
Measurement of [Ca2+]i Using Fura-2
Measurement of [Ca2+]i using single cell ratio imaging of fura-2
fluorescence was performed as described previously (Tertyshnikova and Fein, 1997
). In brief, cells were plated on glass coverslips and incubated with 2.5 µM fura-2/AM in HPSS for 30 min. Then
extracellular fura-2/AM was washed away and cells were incubated for an additional 1 h. Fluorescence images at 340 and 380 nm were collected at a rate of 1 Hz using an intensified CCD
camera (Ionoptix) and analyzed using the program Ionwizard
4.1 (Ionoptix). To determine the rate of Mn2+ influx, fura-2 fluorescence was excited at 360 nm and fluorescence emission was
measured at 510 nm. In the experiments measuring [Ca2+]i or
Mn2+ influx, cells were initially incubated in 200 µl of the indicated solution and stimulation of the cells was achieved by adding 800 µl of new solution that brought the final concentration
of reagents and/or [Ca2+]o to the indicated concentration.
Electrophysiology
Standard whole cell patch clamp techniques were employed
(Hamill et al., 1981
). Recording pipettes were pulled from borosilicate filament glass (Sutter Instrument Co.) using a multistep
puller (Sutter Instrument Co.). Pipettes were coated with SylgardTM near the tip and were fire-polished. Pipette resistance was
2-5 M
. An Axopatch 1D amplifier (Axon Instruments Inc.) was
used for recording from the pipette under voltage or current
clamp. The output signal was lowpass filtered at 2 kHz and digitized at a rate of 10 kHz using a TL-1 interface. Experimental
data were acquired and analyzed using pClamp 6.0 software
(Axon Instruments Inc.) on an IBM-compatible 80486 computer.
Extracellular solution changes were made using a DAD-6 computer-controlled local superfusion system (ALA Scientific Instruments). All patch-clamp experiments were carried out at room
temperature (22-25°C).
Measurement of the Cell Membrane Potential Using the Potentiometric Dye Tetramethylrhodamine ethyl ester
The potentiometric dye tetramethylrhodamine ethyl ester (TMRE)
was used to determine the plasma membrane potential following the protocol described by Loew (1993)
. Cells were plated on glass coverslips and incubated in HPSS buffer containing 0.1 µM TMRE (a gift from Dr. Loew's laboratory, University of Connecticut Health Center) for 10 min. A series of confocal fluorescent images of the cells were collected using a confocal microscope (CLSM 410; Carl Zeiss, Inc.) at the rate of 0.1 Hz and were saved as TIF
files. Mean intracellular fluorescence intensity was measured within the perinuclear membrane area of each cell using the software program NIH Image (http://rsb.info.nih.gov/nih-image/download.html). After subtraction of background fluorescence,
the mean intracellular and extracellular fluorescence intensity was
used to calculate the plasma membrane potential using following
equation: V=
58 log(Fin*B/Fout)mV,
where Fin and Fout are the
intracellular and extracellular fluorescence intensity, respectively.
B represents the ratio of Fout/Fin obtained when the cell is depolarized with a solution containing 140 mM K+ to correct for nonpotentiometric binding of TMRE.
Various K+ channel antagonists, tetraethylammonium (TEA), quinine, charybdotoxin (CTX), d-tubocurarine, clotrimazole, and apamin were purchased from Sigma Chemical Co.
Reverse Transcription-PCR of Intermediate Conductance K(Ca) Channel hKCa4 in HEL Cells
Total RNA was isolated from V-HEL and AS-HEL cells by lysing
5 × 106 cells in 1 ml TRIAZOL reagent following the method described in the kit (Life Technologies, Inc.). RNA purity was estimated by spectrophotometry using the A260/A280 ratio and the
concentration was estimated at A260, as described by Ausubel et
al. (1994)
. Total RNA extracts were also separated on a denaturing formaldehyde agarose gel (wide range/standard 3:1; Sigma
Chemical Co.) to further assess their purity. RNA (5 µg) from
V-HEL and AS-HEL cells was reverse transcribed by the method described (kit manual; Clontech). cDNA (2-5 µg) was amplified by
PCR using primers designed to amplify a 201-bp fragment of the
intermediate conductance calcium-activated potassium channel
hKCa4 (Logsdon et al., 1997
). The primer sequences were: forward primer, 5'-TTGCTGGAGCAGGAGAAGTCT; backward
primer, 5'-GACCTCTTTGGCATGAAAGGC. The PCR protocol
was: (a) 94°C, 3 min; (b) 58°C, 1 min; (c) 72°C, 1 min; for 40 cycles, followed by 72°C for 10 min and cooling to 4°C using a minicycler (MJ Research, Inc.).
-Actin primers (amplimer set; Clontech) were used to quantify the amount of cDNA used for each
PCR amplification. The amplified products were separated on a
1.3% agarose gel and detected by ethidium bromide. The

174rf/dna/haeiii fragments (Life Technologies, Inc.) were
used as molecular weight markers. The PCR products were purified using a column (QIAGEN Inc.) followed by precipitation to
concentrate the cDNA, which was resuspended in water at a concentration of 50 ng/µl and sequenced at the UCHC Molecular
Core Facility using the forward primer described above.
| |
RESULTS |
|---|
|
|
|---|
Reduced Expression of the GAP1IP4BP in Antisense-transfected Cells
HEL cells were first transfected with the p3'SS plasmid. One clone (LacI-HEL) was used for the cotransfection with pOPRSVICAT or pOPRSVIGAP1IP4BPAS plasmids (see MATERIALS AND METHODS). 10 colonies of pOPRSVIGAP1IP4BPAS plasmid-transfected cells as well as three colonies of pOPRSVICAT plasmid-transfected cells were selected at a geneticin concentration of 300-400 µg/ml and were cloned. The presence of the pOPRSVIGAP1IP4BPAS plasmid in genomic DNA was verified by PCR reaction using a pOPRSVIGAP1IP4BPAS plasmid-specific primer pair (data not shown). The expression of the GAP1IP4BP protein in the 10 clones of pOPRSVIGAP1IP4BPAS-transfected cells were compared with that of pOPRSVICAT-transfected cells using Western blot analysis. Among the pOPRSVIGAP1IP4BPAS-transfected cells, one clone, designated AS-HEL, showed 87 ± 1.5% (mean ± SEM, n = 3) reduction of the GAP1IP4BP protein without induction by IPTG (Fig. 1) while the other nine clones did not exhibit a significant difference from the control cells (data not shown). IPTG caused further reduction of GAP1IP4BP (96%). The AS-HEL clone, maintained in culture without induction by IPTG, and a pOPRSVICAT-transfected clone (V-HEL) were used to study the effect of reduced expression of GAP1IP4BP on calcium entry.
|
Effect of Reduced GAP1IP4BP Expression on Calcium Entry
HEL cells respond to thrombin stimulation with a rise
in [Ca2+]i resulting from an initial release of Ca2+ from
internal stores followed by store-operated calcium entry (Somasundaram et al., 1997
). First, we established that
thrombin-stimulated calcium mobilization in LacI-HEL
cells, the parental cell line of AS-HEL and V-HEL cells,
was similar to that of nontransfected HEL cells (Somasundaram et al., 1997
) (data not shown). When V-HEL and AS-HEL cells were stimulated with 0.5 U/ml
thrombin in the presence of 1.8 mM [Ca2+]o, a rapid
increase of [Ca2+]i was observed in both cell lines. The
time course of [Ca2+]i in thrombin-stimulated V-HEL
cells (Fig. 2 a) is similar to that in the LacI cells (data
not shown). However, in AS-HEL cells the rise of
[Ca2+]i was prolonged for ~100 s compared with
V-HEL cells (Fig 2). [Ca2+]i in AS-HEL cells began to
decline with an initial slope similar to that of V-HEL
cells, but in contrast to the latter did not return to baseline for at least 10 min. These findings demonstrate that calcium mobilization in AS-HEL cells is greatly
prolonged relative to that of V-HEL cells, which could
be due to an effect on release of internal stores and/or
calcium entry.
|
Thapsigargin, an inhibitor of the endoplasmic reticulum (ER) Ca2+-ATPase pump, has been used to deplete
calcium stores, which activates store-operated calcium
entry without the production of InsP3 (Takemura et al.,
1989
). When AS-HEL and V-HEL cells were stimulated
with 5 µM thapsigargin in calcium free HPSS, a similar
slow and prolonged rise in [Ca2+]i was observed in both
cell types (Fig. 3). The rise of [Ca2+]i is caused by leakage of calcium from the internal stores when the ER
Ca2+-ATPase pump is inhibited by thapsigargin. In the
absence of extracellular calcium, the amplitude and
time course of the rise in [Ca2+]i were similar, indicating that the rate of calcium leaking from intracellular
stores and the rate of calcium extrusion from cytoplasm are similar in AS-HEL and V-HEL cells (Fig. 3).
At 400 s, when [Ca2+]i had returned to baseline, extracellular calcium was restored to 1.8 mM and a second
rise of [Ca2+]i, which resulted from calcium entry, was
observed in both cell types. The amplitude of the second [Ca2+]i peak was substantially greater in AS-HEL
than in V-HEL cells, indicating that calcium entry was
specifically enhanced in AS-HEL cells.
|
Since the amplitude of the second peak of [Ca2+]i
upon restoring calcium to the extracellular medium is
influenced by both the rate of Ca2+ entry and the rate
of Ca2+ extrusion, we used Mn2+ to assess the rate of
calcium entry in AS-HEL cells. Manganese is widely
used as a surrogate cation to monitor calcium entry (reviewed by Fasolato et al., 1994
) because it is believed to enter cells through the same pathways used by Ca2+.
Therefore, the rate of quenching of fura-2 fluorescence
by Mn2+ can be used to estimate the rate of calcium entry. As shown in Fig. 4, fura-2-loaded AS-HEL and
V-HEL cells were stimulated with 5 µM thapsigargin in
calcium-free HPSS solution for 400 s, and then 1 mM
MnCl2 was added to the extracellular medium. The
rate of Mn2+ quenching of fura-2 fluorescence is shown
as the percentage of remaining fluorescence compared
with that at the time when Mn2+ was added. Note that
the initial rate of quenching was only slightly greater in
AS-HEL cells, although the findings in Fig. 3 indicate that the reduction in GAP1IP4BP protein is associated
with much enhanced Ca2+ entry.
|
Lanthanum has been used to block a variety of calcium channels including voltage-gated calcium channels (McDonald et al., 1994
) and the channels responsible for capacitative calcium entry (Zhu et al., 1996
).
Therefore, AS-HEL cells were treated with 5 µM thapsigargin for 400 s in Ca2+-free HPSS solution, followed by
addition of 1.8 mM extracellular calcium in the presence of different concentrations of La3+. As shown in
Fig. 5, La3+ blocked calcium entry in AS-HEL cells in a
dose-dependent manner, supporting the notion that
calcium entry in AS-HEL cells is via the capacitative calcium entry pathway.
|
Electrophysiological Basis for Enhanced Calcium Entry in AS-HEL Cells
The current designated ICRAC is believed to be mainly
responsible for calcium entry in the HEL cells (Somasundaram et al., 1997
), so that an increase in either the
number or the activity of the channels could increase
calcium entry. The plasma membrane potential may
also influence store-operated calcium entry (reviewed in Parekh and Penner, 1997
). Hyperpolarization of the
plasma membrane will facilitate calcium entry carried
by ICRAC because of the inward rectification of ICRAC. In
addition, hyperpolarization would also increase the
electrical driving force for calcium entry. The discrepancy between calcium entry determined by [Ca2+]i
measurement (Fig. 3) and Mn2+ influx (Fig. 4) either
indicates that Ca2+ and Mn2+ enter the cell via different pathways or, alternatively, that enhanced calcium
entry in AS-HEL cells requires the presence of extracellular calcium. Many cells have K(Ca) or chloride channels that will hyperpolarize cells upon calcium mobilization. To determine which of the two mechanisms described above is responsible for the enhanced calcium
entry observed in AS-HEL cells, whole cell patch clamp
recording experiments were performed.
AS-HEL Cells Have a Calcium-activated Current
To determine whether any calcium-activated current
was present in AS-HEL or V-HEL cells, whole cell recording was performed with internal solution 1, which
allows for distinguishing between potassium currents
and chloride currents based on their different reversal
potentials. After establishment of whole cell recording, a voltage ramp ranging from
120 to +100 mV with a
duration of 100 ms, which was applied every 2 s (Fig. 6
a), elicited a small and almost linear current in AS-HEL
cells (Fig. 6 b, 1). Then the cell was stimulated with 2 µM thapsigargin and a current gradually developed
over 100 s with a reversal potential of around
75 mV (Fig. 6 b, 2). To determine the current-voltage relationship more accurately, a set of voltage steps ranging
from
120 to +100 mV in 20-mV increments and with
a duration of 100 ms were applied at the indicated
times (Fig. 6 d). The current appears to be activated by
calcium influx because it diminished slowly when the
extracellular solution was switched to a calcium-free external solution (solution 4) and it recovered again
when extracellular calcium was restored (Fig. 6, b, 3 and c). After being activated, the current gradually declined to baseline over the next 600 s. Similar results
were observed in five other AS-HEL cells. In contrast,
V-HEL cells failed to develop a similar current (n = 10 cells, data not shown). These findings show that stimulated AS-HEL cells exhibit a calcium-activated potassium current (IK(Ca), see below) that was either not
present or not activated in V-HEL cells.
|
V-HEL Cells Lack IK(Ca)
There are two possible explanations for the lack of IK(Ca) in V-HEL cells stimulated with thapsigargin: either the cells do not have functional K(Ca) channels, or the cells have such channels but the calcium influx in the V-HEL cells was not sufficient for their activation. In the latter case, similar IK(Ca) should be induced in both AS-HEL and V-HEL cells when the cells are dialyzed with the same concentration of Ca2+ in the pipette solution. Accordingly, AS-HEL and V-HEL cells were dialyzed with an internal solution in which free Ca2+ was buffered to a given concentration using an EGTA-Ca/EGTA buffering system and the current-voltage relationship in the presence of each Ca2+ concentration was determined using voltage steps (Fig. 7). In V-HEL cells, no appreciable Ca2+-dependent current was observed (Fig. 7 a), whereas in the AS-HEL cells IK(Ca) is clearly present, and the activation of the current is dependent on the free Ca2+ concentration in the pipette solution (Fig. 7 b). When LacI-HEL cells were dialyzed with a pipette solution containing 1 µM Ca2+, no appreciable IK(Ca) was detected (n = 5 cells, data not shown). These results indicate that LacI-HEL and V-HEL cells lack the IK(Ca) that is present in AS-HEL cells.
|
The activation of IK(Ca) in AS-HEL cells by Ca2+ was further analyzed by plotting the current induced at the voltage step to +20 mV (from Fig. 7 b) with the addition of data from cells dialyzed with 10 nM Ca2+, as a function of the free calcium concentration. As shown in Fig. 7 c, the data were fit with the Hill equation: I = (Imax)/[1 + (C1/2/C)n] in which the IK(Ca) is half maximally activated at a calcium concentration of C1/2 = 0.4 µM with a Hill coefficient of n = 4.
Potassium Is the Carrier for the Calcium-dependent Current of AS-HEL Cells
We suggested that the calcium-activated current in AS-HEL cells was IK(Ca) because it had a reversal potential
of
75 mV, which is close to the equilibrium potential
of potassium (Ek =
86 mV) and far from the equilibrium potential of Cl
(ECl = 0 mV). To confirm that potassium is the carrier of the current, AS-HEL cells were
dialyzed with a pipette solution containing 140 mM K+
and 1 µM Ca2+ to activate the calcium-dependent current. The current-voltage (I-V) relationship was determined in external solutions containing either 4.5, 45, or 140 mM K+ using the voltage step protocol shown in
Fig. 6. The reversal potential of the calcium-activated
current was determined by plotting the I-V relationship for each K+ concentration (Fig. 8 a). The data in
Fig. 8 b show that the reversal potential of the current
is dependent on [K+]o and that a 10-fold change of
[K+]o results in a 50.1-mV shift in reversal potential, a
value close to the expected shift (58 mV/10-fold
change of [K+]o) for a perfectly selective potassium
conductance. The results confirm that the current is a
calcium-activated potassium current IK(Ca).
|
Time Course of the IK(Ca)
IK(Ca) develops ~30-60 s after the cell is stimulated with
thapsigargin and reaches its peak at ~100 s, and then
gradually declines almost to baseline in ~500-600 s
(Fig. 6 c). A similar time course was observed in five
other cells. The time course of the disappearance of
IK(Ca) in AS-HEL cells may follow the course of disappearance of calcium entry, or alternatively it may reflect a rundown process as suggested by others (Mahaut-Smith and Schlichter, 1989
; Huang and Rane,
1993
; Draheim et al., 1995
). To test this, AS-HEL cells
were dialyzed with 1 µM Ca2+ and the time course of
appearance and disappearance of the current was monitored using voltage ramps. As shown in Fig. 9, IK(Ca) activated by dialysis with internal Ca2+ has a similar
course of appearance and disappearance as that seen
when IK(Ca) is activated by exposure to thapsigargin, indicating that the decay of IK(Ca) reflects a rundown process. Dialysis of four other cells with 1 µM Ca2+ resulted
in a similar time course of the disappearance of the IK(Ca) but with variable onset time (data not shown),
presumably due to differing rates of dialysis from the
patch pipette.
|
IK(Ca) Is Not Regulated by InsP4
It was reported that InsP4 together with Ca2+ activated a
K(Ca) channel in a smooth muscle cell line (Molleman
et al., 1991
). Since reduced expression of GAP1IP4BP
protein in HEL cells is associated with the appearance
of a calcium-activated potassium current, it is possible
that GAP1IP4BP may have an inhibitory effect on the
K(Ca) channels and that activation of these channels
requires both free Ca2+ and InsP4, as suggested by
Molleman et al. (1991)
. In AS-HEL cells, this postulated inhibitory effect of the GAP1IP4BP would be eliminated by the reduction of the GAP1IP4BP and therefore
the IK(Ca) could be activated by Ca2+ alone, whereas in
V-HEL cells the presence of the GAP1IP4BP might inhibit the channel and dialysis with Ca2+ alone would be
unable to activate the channel. To test this possibility, AS-HEL and V-HEL cells were dialyzed with a pipette
solution containing 50 µM InsP4 and 1 µM Ca2+, which
is sufficient to activate IK(Ca) in AS-HEL cells. As can be
seen in Fig. 10, the presence of 50 µM InsP4 in the pipette solution had no effect on the I-V relationship of
either AS-HEL or V-HEL cells. Thus, we did not find evidence to support the idea that InsP4 directly regulates
IK(Ca) in AS-HEL or V-HEL cells.
|
Calcium Mobilization Causes Hyperpolarization in AS-HEL Cells
When calcium is mobilized by thrombin or thapsigargin, the activation of IK(Ca) in AS-HEL cells should hyperpolarize the plasma membrane, increasing the amplitude of the inwardly rectifying ICRAC as well as providing a greater electrical driving force for Ca2+ entry. To
examine the extent of membrane hyperpolarization
during calcium mobilization, whole cell current clamp
experiments were performed. Cells were incubated in
external solution 3 and the whole cell recording configuration was obtained with internal solution 2. Afterwards, cells were superfused for 2 min with calcium-free external solution 4 containing 2 µM thapsigargin,
and then challenged with 1.8 mM Ca2+ in external solution 3. In both V-HEL and AS-HEL cells, stimulation with 2 µM thapsigargin in the absence of extracellular
calcium did not cause significant changes in membrane
potential (Fig. 11 a), presumably because the EGTA-Ca/
EGTA in internal solution 2 buffered the slow rise of
[Ca2+]i caused by thapsigargin. However, upon the restoration of extracellular calcium, the membrane potential of AS-HEL cells hyperpolarized from
40 to
70
mV while that of V-HEL cells remained relatively unchanged (Fig. 11 a). These results indicate that the presence of IK(Ca) in the AS-HEL cells leads to hyperpolarization of the plasma membrane during calcium entry.
|
We also used the potentiometric dye TMRE (see MATERIALS AND METHODS) to independently confirm that the membrane potential of AS-HEL cells hyperpolarized during calcium mobilization. The use of TMRE to measure membrane potential has the advantage that cells remain intact during the measurement. As shown in Fig. 11 b, 2 µM thapsigargin hyperpolarized the membrane potential of AS-HEL cells, while that of V-HEL cells remained relatively unchanged. The AS-HEL cells also hyperpolarized when treated with thrombin but at a faster initial rate than with thapsigargin (0.9 vs. 0.33 mV/s).
Pharmacology of the IK(Ca) in AS-HEL Cells
The role of membrane hyperpolarization in calcium
entry was studied using specific blockers of IK(Ca). To
identify specific blockers of IK(Ca) in AS-HEL cells, we dialyzed cells with a pipette solution containing 1 µM Ca2+
to activate IK(Ca), and then the cells were superfused with
known blockers for different K(Ca) channels (Kohler
et al., 1996
; Ishii et al., 1997
). IK(Ca) was blocked by 1 µM
clotrimazole and partially blocked by 10 mM TEA, but
was not blocked by 10 µM quinine, 100 nM apamin, or
100 µM d-tubocurarine (Fig. 12 a). Furthermore, IK(Ca) was blocked by CTX with a half-maximal concentration
(IC50) of 21 nM (Fig. 12, b and c). Fig. 12 b shows that
100 nM CTX effectively blocks IK(Ca) in AS-HEL cells and
is sufficient to shift the reversal potential of the I-V
curve from
70 mV to about
40 mV. The hyperpolarization (monitored with TMRE) caused by thapsigargin
(n = 13 cells) and thrombin (n = 13 cells) was also inhibited by CTX, indicating the requirement of K(Ca)
channels in the response to those stimuli (data not
shown).
|
Blockade of IK(Ca) by CTX Inhibits Enhanced Calcium Entry in AS-HEL Cells
Our results demonstrate that AS-HEL cells have a CTX-sensitive IK(Ca) that hyperpolarizes the cells upon calcium influx. The ability to block these channels with CTX enabled us to test whether hyperpolarization produced by IK(Ca) is necessary for the enhanced calcium entry observed in stimulated AS-HEL cells. Fura-2- loaded cells were stimulated with 5 µM thapsigargin in calcium-free HPSS, and 400 s later extracellular calcium was restored to 1.8 mM with or without CTX. Addition of 100 nM CTX reduced the enhanced calcium entry in AS-HEL cells back to a level similar to that observed in the V-HEL cells (Fig. 13), while CTX had no significant effect on calcium entry in V-HEL cells. These results indicate that the membrane hyperpolarization produced by IK(Ca) was necessary for the enhanced calcium entry seen in AS-HEL cells.
|
If membrane hyperpolarization is responsible for the
enhanced Ca2+ entry in AS-HEL cells, it should be possible to demonstrate comparably enhanced Ca2+ entry
in V-HEL cells simply by hyperpolarizing the membrane by lowering [K+]o. First we verified, using TMRE
to monitor membrane potential, that V-HEL cells
bathed in K+-free HPSS, in which NaCl was substituted
for KCl, were hyperpolarized from a resting potential
of
42 mV to a potential of
62 mV (SEM 1.9; n = 27 cells). Fura-2-loaded cells were stimulated with 5 µM
thapsigargin to empty Ca2+ stores, and 400 s later extracellular Ca2+ was restored to 1.8 mM with or without K+
in the HPSS. Hyperpolarization of the membrane by
lowering [K+]o to zero clearly enhanced Ca2+ entry in
V-HEL cells (Fig. 14).
|
Identity of the K(Ca) Channels in the AS-HEL Cells
K(Ca) channels can be grouped into three classes
based on their unitary conductance, voltage dependence, and pharmacological characteristics (Latorre
et al., 1989
; Hille, 1992
; Ishii et al., 1997
). The large
conductance K(Ca) channels (BK or maxiK channels) have a unitary conductance of 80-250 pS, the current is
activated by the concerted action of Ca2+ and depolarization, and the channels are blocked by CTX. Small conductance (SK) Ca2+-activated potassium channels
have a unitary conductance <20 pS and the current is
activated by calcium alone, and may be blocked by
apamin and/or d-tubocurarine. Intermediate conductance Ca2+-activated channels have a conductance of
20-80 pS, the current is activated by Ca2+ without a requirement for depolarization, and they are blocked by
CTX. The K(Ca) channels of AS-HEL cells differ from
BK channels in that their activation is only dependent
on Ca2+ and does not require depolarization. The sensitivity of the K(Ca) channels in AS-HEL cells to CTX
and clotrimazole, but not apamin or d-tubocurarine,
distinguishes them from SK channels (Kohler et al.,
1996
). Recently, a human cDNA encoding an IK channel was cloned independently by three groups and designated as hIK1 (Ishii et al., 1997
), hSK4 (Joiner et al.,
1997
), and hKCa4 (Logsdon et al., 1997
). Like the
cloned hIK1 channel and hKCa4 (Ishii et al., 1997
;
Logsdon et al., 1997
), the K(Ca) channels of AS-HEL cells are blocked by both CTX and clotrimazole, and
therefore their properties resemble the properties of
those channels. One possible explanation for the presence of IK(Ca) in AS-HEL cells is that the level of transcription of mRNA for the channel is upregulated in
AS-HEL cells.
mRNA for an Intermediate Conductance Ca2+-activated K+ Channel in HEL Cells
We therefore examined expression of mRNA for
hKCa4, a human IK channel with similar physiological
and pharmacological properties to the K(Ca) channels
in AS-HEL cells. Primers were designed to amplify a
201-nucleotide fragment of the human intermediate
conductance K(Ca) channel hKCa4 that is present in
lymphocytes (Logsdon et al., 1997
). We first amplified
a fragment of the expected size by PCR of cDNA derived by reverse transcription from total RNA of several
cultured cells of hematopoietic origin (i.e., HEL, Jurkat, and RPMI-288, a B cell). PCR of the cDNA from
V-HEL and AS-HEL also amplified a fragment of the
same size, which was sequenced and found to be identical to hKCa4 (Logsdon, 1997). The quantity of the amplified cDNA fragment for hKCa4 was similar in the
V-HEL and AS-HEL cells (Fig. 15). The
-actin primers
amplified the actin fragment in each cell transfectant
to the same level, indicating that the starting amount of
cDNA was equivalent in the V-HEL and AS-HEL cells.
Thus, the amount of mRNA for hKCa4 was the same in
both HEL cell transfectants. However, this does not
rule out the possibility that a different gene might encode the K(Ca) channel present in AS-HEL cells.
|
| |
DISCUSSION |
|---|
|
|
|---|
The original goal of this study was to determine whether GAP1IP4BP was involved in the activation or regulation of calcium entry that occurs subsequent to unloading of internal calcium stores. A HEL cell line was successfully established in which the expression of GAP1IP4BP was markedly reduced using transfection with a viral vector containing antisense GAP1IP4BP DNA under control of an RSV promoter. We found that thrombin and thapsigargin caused much larger calcium entry in AS-HEL cells than in control V-HEL cells, and that AS-HEL cells selectively exhibited a hyperpolarization due to IK(Ca). When IK(Ca) was eliminated with CTX, calcium entry in AS-HEL cells was reduced back to that occurring in V-HEL cells. These results indicate that the basal activation of store-operated calcium entry in HEL cells is unaffected by the reduced expression of GAP1IP4BP in AS-HEL cells, but that deficiency of GAP1IP4BP results in an enhanced influx of Ca2 that results from membrane hyperpolarization caused by activation of K(Ca) channels.
We cannot conclude what role, if any, GAP1IP4BP plays in regulation of the basal calcium entry. Nor do our experiments address a possible role for InsP4 in calcium entry. Whether InsP4 and GAP1IP4BP are involved in regulation of calcium entry will require further study. However, it is clear that the presence of a K(Ca) channel-mediated current, which hyperpolarizes the plasma membrane upon calcium mobilization, occurred as a result of the loss of the GAP1IP4BP and was required for the enhanced calcium entry in the AS-HEL cells. Furthermore, our results demonstrate a close relationship between K(Ca) channels and calcium entry (see below).
Activation of IK(Ca) by Calcium Entry
With a weak calcium buffer in the pipette solutions, activation of IK(Ca) and hyperpolarization were apparently
dependent on Ca2+ entry because they required the
presence of extracellular Ca2+ (Figs. 6 and 11 a). However, since the Ca2+ EC50 for activation of IK(Ca) in AS-HEL cells was 400 nM, the K(Ca) channels might be activated by Ca2+ released from internal stores in the absence of Ca2+ buffers. Nevertheless, our results suggest
that Ca2+ influx through the plasma membrane may
play a more important role in the activation of the
K(Ca) channels. Activation of IK(Ca) by calcium entry
was also observed in mouse and rat lymphocytes. In
mouse T lymphocytes, the membrane potential, measured using oxonol fluorescence, hyperpolarized when
cells were stimulated with concanavalin A in a saline solution containing 1 mM Ca2+ but not in a Ca2+-free solution (Tsien et al., 1982
). Using a similar method for measuring the membrane potential, Wilson et al.
(1994)
found that release of the intracellular calcium
stores of rat T lymphocytes by thapsigargin caused hyperpolarization of the cells that was dependent on calcium
entry because it was blocked by 5 mM Ni2+. Furthermore, K(Ca) channels may be preferentially activated by Ca2+ entry because the free Ca2+ concentration
beneath the plasma membrane, where the store-operated calcium channels are located, will likely be higher
than the whole cell average [Ca2+]i. In addition, a Ca2+-activated chloride current is also preferentially activated by Ca2+ entry through the store-operated pathway in Xenopus oocytes (Hartzell, 1996
).
The Time Course of IK(Ca)
When AS-HEL cells were stimulated with thapsigargin
in the presence of extracellular Ca2+, IK(Ca) was activated within 1 min, and then gradually declined close
to its basal level in ~10 min. The time course of IK(Ca) may reflect the kinetics of Ca2+entry, or alternatively it
may reflect intrinsic regulation of the K(Ca) channel
by some unknown mechanism. Our results support the
latter hypothesis, because IK(Ca) activated by constant internal dialysis with Ca2+ disappeared with a similar time
course as when activated by thapsigargin (Fig. 9). Similar results were observed in rat T lymphocytes and ras-
and src-transformed fibroblasts (Mahaut-Smith and
Schlichter, 1989
; Huang and Rane, 1993
; Draheim et al.,
1995
). Mahaut-Smith and Schlichter (1989)
reported
that single K(Ca) channel activity, recorded with cell-
attached patch, could be activated by treating rat T lymphocytes with ionomycin plus extracellular calcium,
but the channel activity decreased even in the continued presence of the ionophore. They also found that
excised patches had a fewer number of activated channels and the percentage of time spent by channels in
the open state was decreased, suggesting a possible desensitization of IK(Ca) with continued exposure to calcium. In src-transformed NIH3T3 cells, dialysis with a
pipette solution containing 1 µM free Ca2+ activated an
IK(Ca) that diminished within 5-10 min. The rundown of IK(Ca) was not due to the washout of intracellular factors because a similar time course for rundown of the
current was observed when the IK(Ca) was measured using nystatin-perforated patch clamp recording with
continuous exposure to A23187 in the presence of 2 mM [Ca2+]o (Draheim et al., 1995
). In ras-transformed
balb3T3 cells, single channel recordings of K(Ca)
channels were obtained in the cell attached configuration while cells were stimulated with A23187 in presence of 1 mM [Ca2+]o (Huang and Rane, 1993
). On exposure to A23187, channel activity appeared and eventually subsided and could not be reactivated by
reapplication of A23187. However, K(Ca) channel activity was restored immediately when the patches were
excised and exposed to a solution containing calcium,
a result contrary to that in rat T lymphocytes (see
above). In contrast, Grissmer et al. (1993)
reported
that IK(Ca) in human T lymphocytes was stable when activated by dialyzing with internal Ca2+ for a period of 10 min. Therefore, the time course of the IK(Ca) rundown
may reflect regulation by unknown cell-specific mechanisms deserving further investigation. Such regulation
may have a significant effect on the time course of calcium entry as discussed below.
Membrane Hyperpolarization Facilitates Calcium Entry
Our results demonstrate that activation of the IK(Ca) has a
profound effect on calcium entry, presumably by hyperpolarizing the plasma membrane. The effect of plasma
membrane hyperpolarization on calcium entry is due to
both the electrophysiological characteristics of ICRAC and a
greater electrical driving force for calcium entry. Somasundaram et al. (1997)
reported that ICRAC is mainly responsible for calcium entry in HEL cells. ICRAC is a non-
voltage-gated, low conductance, highly calcium selective
current that can be activated by releasing internal calcium
stores (reviewed by Parekh and Penner, 1997
). Although
activation of ICRAC is not controlled by plasma membrane
potential, the channel activity is voltage-dependent because the current rectifies inwardly, especially in the voltage range below 0 mV (Hoth and Penner, 1992
; Somasundaram et al., 1997
). Therefore, once ICRAC is activated
by release of internal stores, hyperpolarization of the
plasma membrane will further increase the amplitude of
the current, thereby causing more calcium entry.
Many nonexcitable cells have K(Ca) channels with
similar electrophysiological characteristics as that of
AS-HEL cells, which can be classified as intermediate
conductance K(Ca) channels (Ishii et al., 1997
; Joiner
et al., 1997
; Logsdon et al., 1997
). K(Ca) channels in
nonexcitable cells are believed to participate in regulation of cell volume and ion secretion (see references in Ishii et al., 1997
; Joiner et al., 1997
; Logsdon et al.,
1997
). It has also been proposed that K(Ca) channels
may facilitate store-operated calcium entry (reviewed
by Lewis and Cahalan, 1995
; Parekh and Penner,
1997
). Here we provide direct experimental evidence
showing that activation of K(Ca) channels in AS-HEL
cells has a profound effect on Ca2+ entry. Once Ca2+
entry is activated, K(Ca) channels may play a significant
role in amplifying the magnitude and time course of
Ca2+ entry. This mechanism provides a powerful tool
for cells to regulate calcium homeostasis.
Does GAP1IP4BP Regulate the Expression or Activity of K(Ca) Channels?
One explanation for the presence of the IK(Ca) in AS-HEL but not V-HEL cells is that the K(Ca) channels are
only expressed in AS-HEL cells. A CTX- and TEA-sensitive IK(Ca) current was present in ras-transformed fibroblasts, but not in control cells (Rane, 1991
; Huang and
Rane, 1993
), and the activation of raf protein kinase,
downstream of ras in the pathway, was necessary and
sufficient for the induction of the current (Huang and
Rane, 1994
). Furthermore, IK(Ca) induced by growth
factors in serum-starved fibroblasts was dependent on
protein phosphorylation and protein synthesis, leading
to the conclusion that the induction of IK(Ca) by ras transformation was due to activation of the ras/raf signaling cascade leading to the expression of the K(Ca)
channels (Huang and Rane, 1994
). Transformation of
NIH3T3 cells with the src oncogene, which acts upstream from ras, also resulted in the expression of a
similar IK(Ca) (Draheim et al., 1995
). Also, the number
of CTX-sensitive K(Ca) channels in human T-lymphocytes increased 20-fold after the mitogenic activation of
the cells (Grissmer et al., 1993
).
We found no difference between AS-HEL and V-HEL cells in hKCa4A mRNA expression. Although this does not rule out possible differences in the synthesis or membrane insertion of functional protein, or that a different K(Ca) channel may be present, we must also consider that in AS-HEL cells some posttranslational modification of the protein (e.g., phosphorylation state) accounts for the ability of K(Ca) channels in AS-HEL cells to be activated by Ca2+.
Since GAP1IP4BP is a GTPase-activating protein, its deficiency may cause a ras-like protein to spend more time in the active GTP-bound state leading to a downstream signal (e.g., ras/raf pathway) that modifies channel function.
Summary
We have established a human erythroleukemia cell line in which the expression of GAP1IP4BP protein is substantially reduced by expression of antisense DNA. This does not change the cell's intrinsic mechanism for store-operated Ca2+ entry, but leads to the appearance of an intermediate conductance K(Ca) channel that can hyperpolarize the cell and significantly influence the amplitude and time course of calcium entry subsequent to discharge of intracellular stores of Ca2+. We propose that in some cells GAP1IP4BP can function as a regulator of agonist-induced calcium influx by affecting the activity of a small GTP-binding protein involved in the expression and/or activity of calcium-activated potassium channels.
| |
FOOTNOTES |
|---|
Address correspondence to Flavia A. O'Rourke, Department of Pharmacology, The University of Connecticut Health Center, Farmington, CT 06030. Fax: 860-679-3693; E-mail: orourke{at}nso1.uchc.edu
Original version received 29 June 1998 and accepted version received 9 November 1998.
The experimental results described here have been submitted in the form of a dissertation as partial fulfillment for the degree of Doctor of Philosophy in Cellular and Molecular Pharmacology at the University of Connecticut Health Center.The authors thank Drs. Robin Irvine and Peter Cullen for providing antiserum against GAP1IP4BP and comments on the manuscript. We thank Drs. Hermes Yeh, Leslie Loew, and Achilles Pappano for their advice and technical support and Susan Kreuger at the Center for Biological Imaging Technology for her technical assistance.
| |
Abbreviations used in this paper |
|---|
AS-HEL, antisense-transfected HEL;
CTX, charybdotoxin;
HEL, human erythroleukemia;
HPSS, HEPES-buffered physiological salt solution;
ICRAC, calcium release activated
calcium current;
InsP3, inositol 1,4,5 trisphosphate;
InsP4, inositol
1,3,4,5 tetrakisphosphate;
IPTG, isopropylthio-
-D-galactoside;
I-V, current-voltage;
RSV, Rous Sarcoma virus;
TEA, tetraethylammonium;
TMRE, tetramethylrhodamine ethyl ester;
V-HEL, vector-transfected HEL.
| |
REFERENCES |
|---|
|
|
|---|